Eoanthropus Dawsoni

In the early 20^th Century archaeologists were desperate to locate the “missing link” between humans and apes. At this time there were multiple theories on how human evolved to their present state. Some archaeologists believed that early man developed a large brain and started to walk upright and become bipedal after the expansion of the brain. Another theory stated that humans started to walk more upright and became bipedal and then the expansion of human brains occurred. This pursuit of knowledge regarding the theories of mans origins led to one of the greatest scientific hoaxes of all time, the Piltdown Man.

                In the year 1908 an amateur paleontologist by the name of Charles Dawson began to excavate a gravel pit in the British town of Piltdown. Dawson came upon this site after he was presented with curious bone fragments that were found by workers at the gravel pit. After some time working on the site, Dawson enlisted the help of Arthur Smith Woodward who was the keeper of the Department of Geology at the British Museum at the time. The two continued to excavate the site until in 1912 when they located jaw and skull fragments that they thought could be the link between man and ape. The bone fragments seemed to show a very human fragments and with an ape like jaw in close proximity to each other inside the gravel pit. Woodward used the bone fragments to reconstruct a full skull which he thought to be of an early human who had lived approximately 500,000 years ago. The skull constructed by Woodard backed up the theory that human brains enlarged before becoming bipedal, this theory was supported by a Scottish anthropologist by the mane of Arthur Keith.

                Some scientists of the day said that the skull fragments didn’t belong together, that they were too different to be a part of the same being. Others were simply excited to finally have a fossil of early man be found in Britain. Yet, eventually, the fossils found by Dawson were later discovered to be a fraudulent.

                For three decades the skull was generally believed to be real. Yet in 1953 advanced methods of fluorine based dating of fossils were used on Dawson’s Piltdown Man fragments. The fluorine based dating showed that the fragments were only 50,000 years old and that Piltdown Man had never existed. Dawson’s find had fooled the world for such a long period of time partly due to potassium dichromate being applied to the fossils to make them appear much older than they actually were. Dawson’s find had effectively delayed proper theories of human evolution for decades.

                Today it is believed that Dawson may have known that the fragments were fraudulent the whole time and merely wanted recognition. This brings in the human element of science. “To err is human” but this was more than a simple “err”. We now know that Martin Hinton possessed the chemicals necessary to apply potassium dichromate to the fragments. Perhaps Dawson asked Hinton to coat the fragments of Piltdown man to complete his hoax. Errors like this can never be completely taken out of science. People have in the past attempted similarly appalling hoaxes, yet scientific review eventually proved them wrong. Incidents like Piltdown Man tarnish the name of science, but eventually the truth is always found by inquisitive minds that use real science to locate the flaws in the pseudo-science that was used before them.

                A life lesson we can take away from the incident of Piltdown Man is don’t skip steps in science. By following the scientific method and leaving as many scientific findings open and available for peer review, incidents like Piltdown Man may not occur again.

The Real Paleo Diet....of Primates

Lemurs are found in Madagascar and have been the sole primates in Madagascar for approximately 65 million years. During this time lemurs have come to occupy all areas of Madagascar. From the Rain forest to the wetlands, and form the grasslands to the forest, lemurs have adapted well to all environments of Madagascar. The diet of the lemur is highly variable; they are known to eat fruit, insects, plants and will sometimes eat small animals. Lemurs have adapted to their environment by developing a complex social structure, very good night vision, and a low metabolic rate. The low metabolic rate assists the lemurs in surviving when food is scarce during dry seasons.

Spider monkeys are found in tropical areas of South America, and require a large area to roam. Spider monkeys are omnivores that have a social structure in which they often pick a female as their leader when foraging for food, primarily fruit. Spider monkeys have adapted to their environment by having a mouth that can open wide enough to swallow most fruits whole. By swallowing the fruits whole, the spider monkeys food foraging time is reduced.

 

Baboons are found primarily in the savannas and semi-arid areas of Central Africa. There is not always an abundance of food in these areas; baboons are omnivores who can opportunistically eat whatever comes their way. Baboons separate and forage for food that may include fruit, grass, seeds, bark, roots, and sometimes even small animals such as rodents and birds during the day. After a long day of finding food, baboons gather into groups at night. Baboons have adapted to their environment by being able to eat and digest a diverse amount of potential food, but they are also selective and prefer to eat items that are higher in protein and fats.

                Gibbons are found in the dense forest s and jungles of India and Indonesia. Gibbons are also omnivores who mainly eat fruit, eggs, and insects. Gibbons have adapted to their environment through their long arms and light bodies which make it easier to climb trees to find food. Gibbons also live in groups which have a complex social structure with an alpha male and female.

 

Chimpanzees are found in the tropical forests and woody savannas of western and Central Africa. They are omnivores who will eat fruit, seeds, insects and sometimes small animals. Chimpanzees have adapted to their environment through their complex social structure and their highly dexterous hands. Chimpanzees are able to and often do use and make tools to assist them in gathering food. A good example of this is that they will often crush the shells of nuts with stones to access the food inside.

                All of these categories of primates are omnivores with complex social structures. Some are specifically adapted to their environment, while others need only rely on their social structure to survive and thrive. It is my opinion that it is their ability to eat and digest a wide variety of potential foods that allows them to adapt to changes in their environment and the occasional shortage of available food. Also, all of these categories possess a complex social structure that allows them to work together to find food.

Analogous vs Homologous Traits

Good examples of two species that appear very different on the surface, but are very homologous in regards to certain traits are humans and dolphins. The dolphin has a forelimb that is known as a flipper, this flipper contains a bone structure that is very similar to that of a human forelimb, an arm. Both species possess a five digits forelimb. Of course you know that you have five (phalanges) fingers, but a dolphin also has five finger like phalanges inside of its flipper. This similarity is derived from a common ancestor millions of years ago. Through the evolutionary process our five phalange structure has allowed us to very good at grasping and handling objects, while the five phalange structure of a dolphin’s flipper is nearly perfectly adapted to assist with movement in the water. To find a common ancestor for humans and dolphins you would have to go back to around the time that the dimetrodon roamed the earth. The dimetrodon also possessed a five phalanges structure in its forelimbs.

Homologous species have very similar traits, while analogous species have very different traits. Great examples of analogous traits are those of a dolphin and a shark. While one may assume that dolphins and sharks are very similar due to both being aquatic species, they are worlds apart genetically. From the outside a shark’s forelimb (pectoral fin) and dolphin’s flipper appear to be very similar, but under the surface the shark does not possess the five phalange structure of the dolphin’s flipper. The pectoral fin of the shark does not have any phalanges inside of it. The pectoral fin of the shark is comprised not of bone like the dolphin, a mammal. The shark is a fish, which has a forelimb comprised of cartilage that bears little resemblance to the dolphin’s flipper. As of yet we have not found a common ancestor between sharks and dolphins. We can assume that dolphins diverged from sharks long before the first mammals roamed the earth so it is not known if any common ancestor possessed this analogous trait.

DNA Code to be Un-coded

I'd say good luck with translating this, but I know you don't need the luck:


GCCGTACGAGCGGCCATTGAGTTGAGAACGGAAGGACATCATTG