Thursday, September 5, 2013

DNA Code to be Un-coded

I'd say good luck with translating this, but I know you don't need the luck:


GCCGTACGAGCGGCCATTGAGTTGAGAACGGAAGGACATCATTG     

Thursday, August 29, 2013

Thomas Malthus and his Influence on Charles Darwin



It is my opinion that Thomas Malthus had the greatest impact on Charles Darwin’s findings and publication regarding the natural selection. This is largely due to an essay Malthus published, An Essay on the Principle of Population. In this essay Malthus argued that advances in the size of the human population could have drastic impacts and consequences in some areas due to lack of available resources, and due to some populations taking resources from other inhabited areas. Thereby, removing the availability of these resources from other populations and decreasing fertility while increasing mortality rates in the areas without proper resources such as clean water.  “Malthus argued that population growth doomed any efforts to improve the lot of the poor. Extra money would allow the poor to have more children, only hastening the nation’s appointment with famine.“ (http://evolution.berkeley.edu/evolibrary/article/history_07) 
Darwin was greatly influenced by the finding of Malthus, yet Darwin applied the ideas Malthus provided to the populations of all living beings on this Earth, instead of just humans. Malthus argument that resources available greatly affected population is a key aspect of the process of natural selection. Lack of resources causes creatures to adapt to the lack of resources over time, or perish.  In conclusion, it is my belief that Darwin would not have reached his conclusion regarding On the Origin of Species without reading the observations of Malthus.
The findings of Malthus helped Darwin considerably, yet other factors worked against Darwin as he honed his theory of Natural Selection.  Darwin was a faithful Christian man, yet he knew that his theories would go against the church. Therefore, Darwin delayed the release of his findings until he had taken meticulous care of his evidence supporting Natural Selection and explained it fully in his book On the Origin of Species.